circad | circRNAs associated with diseases

hsa_circRNA_070616/hsa_circ_0070616
Gene	PAPSS1	Organism	Human
Genome Locus	chr4:108608194-108622441:-	Build	hg19
Disease	Repeated implantation failure	ICD-10	n/a (n/a)
DBLink	Link to database	PMID	29132137
Experimental Method
Sample Type	Endometrial Tissues	Comparison	Three pairs of snap-frozen endometrial tissue with repeated implantation failure patients and control group
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAACAGAGGGATATCAAAAGG Reverse GGTAGGTGAACATTGGTTGCTCT	Statistics	Fold Change : Upregulated,16.533145 pvalue : p=0.00004447
Citation
Liu, L, Li, L, Ma, X, Yue, F, Wang, Y, Wang, L, Jin, P, Zhang, X (2017). Altered Circular RNA Expression in Patients with Repeated Implantation Failure. Cell. Physiol. Biochem., 44, 1:303-313.